View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20142_low_8 (Length: 273)
Name: NF20142_low_8
Description: NF20142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20142_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 16 - 246
Target Start/End: Complemental strand, 34932873 - 34932643
Alignment:
| Q |
16 |
atacgcacacggaataactcctgcgcacatgttcgacaacattcctgtgtttaaagccgaggcaagcttttctggggcctgtagcaaatgctttctttta |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932873 |
atacacacacggaataactcctgcgcacatgttcgacaaccttcctgtgtttaaagccgaggcaagcttttctggggcctgtagcaaatgctttcttttg |
34932774 |
T |
 |
| Q |
116 |
attctagtttcactattttagtttctttgtgcgtattctagttctttaatattacttactctttaaacccacaggatcccgaactggtatcgcttcagca |
215 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| | |
|
|
| T |
34932773 |
attctagtttcacaattttagattctttgtgcgtattctagttctttaatattacttactctttaaacccacaggatctcgaactggcatcgcttcagaa |
34932674 |
T |
 |
| Q |
216 |
atggcttgatgaaatagaaagtgagaagaat |
246 |
Q |
| |
|
| ||||||| |||||||| ||||||||||| |
|
|
| T |
34932673 |
aatgcttgataaaatagaatgtgagaagaat |
34932643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 184
Target Start/End: Complemental strand, 38648688 - 38648614
Alignment:
| Q |
110 |
cttttaattctagtttcactattttagtttctttgtgcgtattctagttctttaatattacttactctttaaacc |
184 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||| | |||| | ||||||||||||| ||| ||| |||||| |
|
|
| T |
38648688 |
cttttgattcaagtttcacaattttagtttctttgttcatatttgaattctttaatattaattaatctataaacc |
38648614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University