View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20143_high_6 (Length: 321)
Name: NF20143_high_6
Description: NF20143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20143_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 7 - 305
Target Start/End: Original strand, 33202653 - 33202956
Alignment:
| Q |
7 |
tcgaagaaaattgcctccattagaaagaaaaacactttggtgactaatgtgcaaaatagtgaaagaatagaacatgcatggcacccaccattcacatgtt |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33202653 |
tcgaataaaattgcctccattagaaagaaaaacactttggtgactaatgtgcaaaatagtgatagaatagaacatgcatggcacccaccattcacatgtt |
33202752 |
T |
|
| Q |
107 |
ttatccctacacatacatg-----gcatggcaatagagatattaaaagcgacccacaagacagcctttacatgcacacacgcaaagataaaaaggcaacg |
201 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33202753 |
ttatccctacacatacatggcatggcatggcaatagagatattaaaagcgacccacaagacagcctttacatgcacacacgcaaagataaaaaggcaacg |
33202852 |
T |
|
| Q |
202 |
atcatggcaatcaaaaagcccctctcactctcttcactttcacaaactaaagcaacgaacgagagcaattctcatcacaacaaaggcattatcataacaa |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33202853 |
atcatggcaatcaaaaagcccctctcactctcttcactttcacaaactaaagcaacgaacgagagcaattctcatcacagcaaaggcattatcataacaa |
33202952 |
T |
|
| Q |
302 |
taac |
305 |
Q |
| |
|
|||| |
|
|
| T |
33202953 |
taac |
33202956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University