View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20143_low_10 (Length: 238)
Name: NF20143_low_10
Description: NF20143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20143_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 3641936 - 3642153
Alignment:
| Q |
1 |
ttcaactgcataatttaattaaatttttatttaaaatgtataaaaaatgatattaagttcatatcatgctttgataaaatgtttacggtgcttttcagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641936 |
ttcaactgcataatttaattaaatttttatttaaaatgtataaaaaatgatattaagttcatatcatgctttgataaaatgtttacggtgcttttcagtt |
3642035 |
T |
 |
| Q |
101 |
cctaccaaatctaggaagnnnnnnnnngatcaatcattgtagtgtaatgagttatgtggcaagaaagggcagttttgataatgccttttatgtcaaattt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3642036 |
cctaccaaatctaggaagaaaaaaaatgatcaatcattgtagtgtaatgagttatgtggcaagaaagggcagttttgataatgccttttatgtcaaattt |
3642135 |
T |
 |
| Q |
201 |
agaatgcacaagagtccg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3642136 |
agaatgcacaagagtccg |
3642153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University