View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20143_low_10 (Length: 238)

Name: NF20143_low_10
Description: NF20143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20143_low_10
NF20143_low_10
[»] chr3 (1 HSPs)
chr3 (1-218)||(3641936-3642153)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 3641936 - 3642153
Alignment:
1 ttcaactgcataatttaattaaatttttatttaaaatgtataaaaaatgatattaagttcatatcatgctttgataaaatgtttacggtgcttttcagtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3641936 ttcaactgcataatttaattaaatttttatttaaaatgtataaaaaatgatattaagttcatatcatgctttgataaaatgtttacggtgcttttcagtt 3642035  T
101 cctaccaaatctaggaagnnnnnnnnngatcaatcattgtagtgtaatgagttatgtggcaagaaagggcagttttgataatgccttttatgtcaaattt 200  Q
    ||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3642036 cctaccaaatctaggaagaaaaaaaatgatcaatcattgtagtgtaatgagttatgtggcaagaaagggcagttttgataatgccttttatgtcaaattt 3642135  T
201 agaatgcacaagagtccg 218  Q
    ||||||||||||||||||    
3642136 agaatgcacaagagtccg 3642153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University