View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20144_high_5 (Length: 222)
Name: NF20144_high_5
Description: NF20144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20144_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 84
Target Start/End: Complemental strand, 22559891 - 22559824
Alignment:
| Q |
17 |
aggtacatgactttctttttcaaactttttatacatcatctcttctaaattagtaactattttatata |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22559891 |
aggtacatgactttctttttcaaactttttatacatcatcacttctaaattagtaactattttatata |
22559824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 147 - 205
Target Start/End: Complemental strand, 22559759 - 22559701
Alignment:
| Q |
147 |
tactacagctttgttcatggaagattaccatatgagaatttgaaaccagacccaattct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22559759 |
tactacagctttgttcatggaagattaccatatgagaatttgaaaccagacccaattct |
22559701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 199
Target Start/End: Original strand, 7277259 - 7277302
Alignment:
| Q |
156 |
tttgttcatggaagattaccatatgagaatttgaaaccagaccc |
199 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
7277259 |
tttgttcatggaagattaccttatgagaacttgaaaccagaccc |
7277302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 205
Target Start/End: Complemental strand, 7302079 - 7302030
Alignment:
| Q |
156 |
tttgttcatggaagattaccatatgagaatttgaaaccagacccaattct |
205 |
Q |
| |
|
||||||||||| |||||||| |||| ||| ||||||||||||||| |||| |
|
|
| T |
7302079 |
tttgttcatgggagattaccttatgtgaacttgaaaccagacccagttct |
7302030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University