View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20146_high_38 (Length: 240)
Name: NF20146_high_38
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20146_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 28545792 - 28546027
Alignment:
| Q |
1 |
caatattccattttcattcaaactctatcaagtatatcttaaatt-------------aattaattaatggagtgatatgataatgtgggcttgatatga |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28545792 |
caatattccattttcattcaaactctatcaagtatatctaaaattaattaatttaattaattaatgaatggagtgatatgataatgtgggcttgatatga |
28545891 |
T |
 |
| Q |
88 |
ttattgaaaggagggacgataagagtagaaaagataagaatctcaaagattcaactaccatcattggcaaaaataagcaactaacttttttattttgtaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28545892 |
ttattgaaaggagggacgataagagtagaaaagataagaatctaaaagattcaactaccatcattggcaaaaataagcaactaacttttttattttgtaa |
28545991 |
T |
 |
| Q |
188 |
aaatcaacaaatttgattaatcaattatatcaagta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28545992 |
aaatcaacaaatttgattaatcaattatatcaagta |
28546027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University