View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20146_high_42 (Length: 236)
Name: NF20146_high_42
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20146_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 41896196 - 41895977
Alignment:
| Q |
1 |
ctttctttggatcaatccattattggtatatcactactttctttactagtgagtacataatatctagcattaaactcatttagattggcttagtgatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41896196 |
ctttctttggatcaatccattattggtatatcactactttctttactagtgagtacataatatctagcattaaacttatttagattggcttagtgatgtt |
41896097 |
T |
 |
| Q |
101 |
ccacatcaatattatgtttaattatctccggtgtcaattttaaatggttaatttaacttcttctttttaaattatattaaagcttttcttttgaataaat |
200 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41896096 |
ccacatcaatattacgtttaattatcttcggtgtcaatttcaaatggttaatttaacttcttttttttaaattatattaaagctttccttttgaataaat |
41895997 |
T |
 |
| Q |
201 |
atatgaattattaaagctat |
220 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
41895996 |
atatggattattaaagctat |
41895977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University