View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20146_high_56 (Length: 202)
Name: NF20146_high_56
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20146_high_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 19 - 180
Target Start/End: Complemental strand, 8704866 - 8704712
Alignment:
| Q |
19 |
aaagtggtgattgttcagagttcagaagctaaagcatgaatttgtaatggtggaaatagggaatagtatgtgtgagagttttgaggttgatcataatatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8704866 |
aaagtggtgattgttcagagttcagaagctaaagcatgaatttgtaatggtggaaatag-------tatgtgtgagagttttgaggttgatcataatatc |
8704774 |
T |
 |
| Q |
119 |
ataggctagttttggctttagctgaataaaaacaaaatataggaaggaaactgtctagtact |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8704773 |
ataggctagttttggctttagctgaataaaaacaaaatataggaaggaaattgtctagtact |
8704712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 14372551 - 14372638
Alignment:
| Q |
97 |
ttttgaggttgatcataatatcataggctagttttggctttagctgaataaaaacaaaatataggaaggaaactgtctagtactacct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
14372551 |
ttttgaggttgatcataatatcataggctagttttggctttagctgaacaaaaacaaaacataggaaggaaactgtctactactacct |
14372638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University