View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20146_low_32 (Length: 296)
Name: NF20146_low_32
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20146_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 12 - 179
Target Start/End: Original strand, 55207796 - 55207963
Alignment:
| Q |
12 |
aattctctaacttgaataggtagcttccgaggtaaggtaggtaaaagaatgaaaaaatatgtcggtggaatggaaatcctagaaaaacaaaaggaagggt |
111 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55207796 |
aattctctatcttgaatagatagcttccgaggtaaggtaagtaaaagaatgaaaaaatatgtcggtggaatggaaatcctagaaaaacaaaaggaagggt |
55207895 |
T |
 |
| Q |
112 |
actatactacgtgtacgtatgcttcagttttggacatgagatgtggcgctttgaattaatttcctttt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55207896 |
actatactacgtgtacgtatgcttcagttttggacatgagatgaggcgctttgaattaatttcctttt |
55207963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 204 - 279
Target Start/End: Original strand, 55207991 - 55208066
Alignment:
| Q |
204 |
aatatctgagtgattattttctttcttttactatgtatgagtcacacacagatcatgcacttggaaatctaaattc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55207991 |
aatatctgagtgattattttctttcttttactatatatgaatcacacacagatcatgcacttggaaatctaaattc |
55208066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University