View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20146_low_37 (Length: 262)
Name: NF20146_low_37
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20146_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 242
Target Start/End: Complemental strand, 28265577 - 28265342
Alignment:
| Q |
7 |
ggatttgacaaatctgagatgaaaatcgagcatagaaaacagtaaattgagattcatcgaagaaaatgcgaaaggagttttagctcagattcgtcaaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28265577 |
ggatttgacaaatctgagatgaaaatcgagcatagaaaacagtaaattgagattcatcgaagaaaatgtgaaaggagttttagctcagattcgtcaaatt |
28265478 |
T |
|
| Q |
107 |
cagaggtagatttgcgtggagaaggagagaggaacctgagagaggaagaagatgcagaaggattcgtcggtgtgtggaagagagaagtgcgagaggagaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265477 |
cagaggtagatttgcgtggagaaggagagagaaacctgagagaggaagaagatgcagaaggattcgtcggtgtgtggaagagagaagtgcgagaggagaa |
28265378 |
T |
|
| Q |
207 |
ggaatggaacgcgggaagtgtgtgattgtaactaac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265377 |
ggaatggaacgcgggaagtgtgtgattgtaactaac |
28265342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University