View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20146_low_45 (Length: 237)
Name: NF20146_low_45
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20146_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 76 - 221
Target Start/End: Original strand, 47591031 - 47591184
Alignment:
| Q |
76 |
tgttgttgggttgagtaattataagtagatagagtaagtagcgcagaaaaagcgttgttgggtttctttgat--------agtgagtgagtcgcgtgcgt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47591031 |
tgttgttgggttgagtaattataagtagatagagtaagtagcgcagaaaaagcgttgttgggtttctttgatagtgagtgagtgagtgagtcgcgtgcgt |
47591130 |
T |
|
| Q |
168 |
tgttacgctcgctcgctaactcgctgtttcttgttgtcgtctttgtctttcttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591131 |
tgttacgctcgctcgctaactcgctgtttcttgttgtcgtctttgtctttcttc |
47591184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 47590990 - 47591031
Alignment:
| Q |
1 |
tggtgtccaagttggaatcaactgagtcgagttcacgaaaat |
42 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
47590990 |
tggtgtctaagttcgaatcaactgagtcgagttcacgaaaat |
47591031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University