View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20146_low_52 (Length: 226)
Name: NF20146_low_52
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20146_low_52 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 27526026 - 27526251
Alignment:
| Q |
1 |
tctcttacaactagtgttgtatagttttttatgttataatacttcatgcataattttgaattccatggacttttatcttatcatacgtaattttgaactt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27526026 |
tctcttactactagtgttgtatagttttttatgttaaaatacttcatgcataattttaaattccatggacttttatcttatcatacgtaattttgaactt |
27526125 |
T |
 |
| Q |
101 |
tggtttcgtaactcctttaatcctcaactcaaaccagttgaactcaaaccatgacattcttatatataggtatcctgttatgactcgggctttagcgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27526126 |
tggtttcgtaactcctttaatcctcaactcaaaccagttgaactcaaaccatgacattcttatatataggtatcctgttatgactcgggctttagcgaaa |
27526225 |
T |
 |
| Q |
201 |
gcaggtcgtccaatcttcttttcgct |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
27526226 |
gcaggtcgtccaatcttcttttcgct |
27526251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 27531672 - 27531741
Alignment:
| Q |
157 |
ttcttatatataggtatcctgttatgactcgggctttagcgaaagcaggtcgtccaatcttcttttcgct |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
27531672 |
ttcttatgtataggtatcctgttatgactcgcgctttaatgaaggcaggtcgtccaatcttcttttcgct |
27531741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University