View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20146_low_56 (Length: 219)

Name: NF20146_low_56
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20146_low_56
NF20146_low_56
[»] chr3 (1 HSPs)
chr3 (1-110)||(1456910-1457015)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 1457015 - 1456910
Alignment:
1 atattatattatcagttatatatgatatttgaattccaacaacttgtgtccccaagtcaaacttttgccaagagccaaaaccacatgggcagcaaagaaa 100  Q
    ||||||||||||||||||||||||| |    |||  |||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||    
1457015 atattatattatcagttatatatgaaa----aatggcaacaacttgtgtcccaaagtcaaacttttgccaagagccaaaaccacatgggcaacaaagaaa 1456920  T
101 aatggatatc 110  Q
    ||||||||||    
1456919 aatggatatc 1456910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University