View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20146_low_57 (Length: 215)
Name: NF20146_low_57
Description: NF20146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20146_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 10 - 200
Target Start/End: Complemental strand, 22222235 - 22222044
Alignment:
| Q |
10 |
tgagatgaagagttgagcggatacttttaggtaacccacctaaagctccaaattggattaaatgatgtttcacatgcacatgacgcaccgtcgtaaaacc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22222235 |
tgagatgaagagttgagcggatacttttaggtaacccacctaaagctccaaattggattaaatgatgtttcacatgcacatgacgcaccgtcgtaaaacc |
22222136 |
T |
|
| Q |
110 |
cagccaattactagaaatatcatgaca-aattttctcnnnnnnnttacaaaagagaaataggtgatctatatcctccactttgccaccacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||| | | ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22222135 |
cagccaattactagaaatatcatgacagatttttcccaaaaaaatcacaaaagagaaataggtgatctatatcctccactttgccacaacca |
22222044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 9090255 - 9090321
Alignment:
| Q |
18 |
agagttgagcggatacttttaggtaacccacctaaagctccaaattggattaaatgatgtttcacatg |
85 |
Q |
| |
|
|||| ||| |||||||||||||| ||||| ||||||||| |||| ||||||||||| |||| |||||| |
|
|
| T |
9090255 |
agagatgaacggatacttttagggaacccgcctaaagcttcaaa-tggattaaatgttgttccacatg |
9090321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University