View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20147_high_31 (Length: 241)
Name: NF20147_high_31
Description: NF20147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20147_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 6 - 225
Target Start/End: Original strand, 52158930 - 52159149
Alignment:
| Q |
6 |
attatcagtgtcaatatgtcactatgttcttgcttcatagctaataacacaccctcagaaccaagtaattattacattgctcagaaagtgttacgtaaaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52158930 |
attatcagtgtcaatatgtcactatgttcttgcttcatagctaataacacaccctcagaaccaagtaattattacattgctcagaaagtgttacgtaaaa |
52159029 |
T |
 |
| Q |
106 |
taatatatatcaacaaaacaacgagcactacaggcactgattcatctaacaagttccataagacgcacaccgaaattcacaaatgcaacatttcaattca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52159030 |
taatatatatcaacaaaacaacgagcactacaggcactgattcatctaacaagttccataagacgcacgccgaaattcacaaatgcaacatttcaattca |
52159129 |
T |
 |
| Q |
206 |
ttttggcgtgacattgggtg |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52159130 |
ttttggcgtgacattgggtg |
52159149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University