View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20147_high_35 (Length: 230)

Name: NF20147_high_35
Description: NF20147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20147_high_35
NF20147_high_35
[»] chr1 (1 HSPs)
chr1 (18-118)||(9870670-9870770)


Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 9870670 - 9870770
Alignment:
18 atattaacatttattgtttttaaaacataattaacatggtataaacttctaatttttccttggagaaagagagtttagataagtacaatcagggtacatg 117  Q
    |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9870670 atattaacatttaccgtttttaaaacataattaacatggtataaacttctaatttttccttggagaaagagagtttagataagtacaatcagggtacatg 9870769  T
118 c 118  Q
    |    
9870770 c 9870770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University