View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20147_high_36 (Length: 227)
Name: NF20147_high_36
Description: NF20147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20147_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 44379152 - 44379364
Alignment:
| Q |
1 |
tctttcatactcatagcaaggtctacacacagggaatgcacattcattgcaagcaacaaaaggttcatcatccactgtaaactctatctcatccctacag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44379152 |
tctttcatactcatagcaaggtctacacacagggaatgcacattcattgcaagcaacaaaaggttcatcatccactgtaaactctatctcatccccacag |
44379251 |
T |
 |
| Q |
101 |
atctggcaaatttgtccactcaattctgtcacagcattcacctgcatttgataagaacaataaatgttacatgcacacatgagacagtacattattttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44379252 |
atctggcaaatttgtccactcaattctgtcacagcattcacctgcatttgataagaacaataaatgttacatgcacacatgagacagtacattattttca |
44379351 |
T |
 |
| Q |
201 |
ctatgcaaattat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44379352 |
ctatgcaaattat |
44379364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 1180041 - 1180100
Alignment:
| Q |
1 |
tctttcatactcatagcaaggtctacacacagggaatgcacattcattgcaagcaacaaa |
60 |
Q |
| |
|
||||||||| ||||| ||| |||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
1180041 |
tctttcatattcataacaatttctacaaacaggaaatgcacattcattgcaagccacaaa |
1180100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University