View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20147_low_26 (Length: 303)
Name: NF20147_low_26
Description: NF20147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20147_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 74 - 212
Target Start/End: Original strand, 26818369 - 26818509
Alignment:
| Q |
74 |
cctattagatagagaattgaacgaggcataatgttgtgaaaaagatggtgaaaattgcatgatcgagagagtgagggt--gggtttgttagttgtgacac |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26818369 |
cctattagatagagaattgaacgaggcataatgttgtgaaaaagatggtgaaaattgcatgatcgagagagtgagggttagggtttgttagttgtgacac |
26818468 |
T |
|
| Q |
172 |
ataaaaacataagtgaatgagattagatcttactagtaccg |
212 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26818469 |
ataaaaacatgagtgaatgagattaggtcttactagtaccg |
26818509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 291
Target Start/End: Original strand, 26818534 - 26818562
Alignment:
| Q |
263 |
ctggcctaaataccgtttcacctttgcta |
291 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26818534 |
ctggcctaaataccgtttcacctttgcta |
26818562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University