View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20148_high_39 (Length: 309)
Name: NF20148_high_39
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20148_high_39 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 17 - 309
Target Start/End: Original strand, 48889646 - 48889938
Alignment:
| Q |
17 |
agcttgctcttattggaattgaatctggggttgtcttacttaacggttcaaatattgtcaccactgtaaaccttggctttgttgtgacagcgtctactat |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48889646 |
agcttgctcttattggaattgaatccggggttgtcttacttaacggttcaaatattgtcaccactgtaaaccttggctttgttgtgacagcgtctactat |
48889745 |
T |
 |
| Q |
117 |
ttcacctgatggcagtgaagcaattgtaggtgggcaagatggtaagctgcatatttattctatctcaggagatacacttacagaacagattgttcttgag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48889746 |
ttcacctgatggcagtgaagcaattgtaggtgggcaagatggtaagctgcatatttattctatctcaggagatacacttacagaacaaattgttcttgag |
48889845 |
T |
 |
| Q |
217 |
aagcaccgaggagcaatcagtgtaatcaaatattcaccgaatgtttccatgtttgcatcagctgatcttaaacgtgaaactgttgtgtgggac |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
48889846 |
aagcaccgaggagcaatcagtgtaatcaaatattctccagatgtttccatgtttgcatcagctgatctaaatcgtgaagctgttgtgtgggac |
48889938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University