View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20148_high_43 (Length: 279)
Name: NF20148_high_43
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20148_high_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 34 - 215
Target Start/End: Complemental strand, 30419454 - 30419274
Alignment:
| Q |
34 |
ttcacacaaagcggaggttaggggacgatgataggttacatcaatcatctttctcatattaccacattatttttcttcacaaacttcccagatggtgata |
133 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30419454 |
ttcacacaaagcggaggttaggggacggtgataggttacatcaatcatctttctcatattaccacattatttttcttcacaaacttctcagatggtgata |
30419355 |
T |
|
| Q |
134 |
gagtggtggatctttgagggnnnnnnnnnctttctaaattcgggagagtgcgagaggtgtatatttcaaaaaagcttaataa |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30419354 |
gagtggtggatctttgaggg-ttttttttctttctaaattcaggagagtgcgagaggtgtatatttcaaaaaagcttgataa |
30419274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University