View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20148_high_55 (Length: 227)
Name: NF20148_high_55
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20148_high_55 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 43634090 - 43633871
Alignment:
| Q |
1 |
atttagacatctgaagtaattcctcgtctgttttggaattgtcagtgctcaaaacaccaataaggctgccatcttcccgtaatctacgtgtgattgctcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43634090 |
atttagacatctgaagtaattcctcgtctgttttggaattgtcagtgctcaaaacaccaataaggctgccatcttcccgtaatctacgtgtgattgctcg |
43633991 |
T |
|
| Q |
101 |
tgtatcaacatcatctgttgcatcacaaagtaccatcaaagtcaagaaaaatccagagtttacatgtaaagttcttgtcataacaactcttcagtcttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43633990 |
tgtatcaacatcatctgttgcatcacaaagtaccatcaaagtcaagaaaaatccagagtttacatgtaaagttcttgtcataacaactc-------ttca |
43633898 |
T |
|
| Q |
201 |
catattacttacaaattcccatgacat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43633897 |
catattacttacaaattcccatgacat |
43633871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 42962333 - 42962206
Alignment:
| Q |
1 |
atttagacatctgaagtaattcctcgtctgttttggaattgtcagtgctcaaaacaccaataaggctgccatcttcccgtaatctacgtgtgattgctcg |
100 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||||||||||| || |
|
|
| T |
42962333 |
atttagacatctggagcaattcctcgtctgttttggaattgtcggtgctcaaaacaccaataaggcttccatcttctcgtaatctgcgtgtgattgcccg |
42962234 |
T |
|
| Q |
101 |
tgtatcaacatcatctgttgcatcacaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42962233 |
tgtatcaacatcatctgttgcatcacaa |
42962206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University