View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20148_high_60 (Length: 213)
Name: NF20148_high_60
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20148_high_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 33415012 - 33414800
Alignment:
| Q |
1 |
cctaactaacttattacctagttaaggcaacaatagtaataacc-aaagtggttgtgaacac-------nnnnnnnnnnngtaacgcttcattttaacac |
92 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||| |||||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
33415012 |
cctaaataacttattacctagttaaggcaataatagtaataaccaaaagtggttgcgaacacttttttttatttctctttgtaacg-ttcattttaacac |
33414914 |
T |
 |
| Q |
93 |
tcttttattggatgaaattcacctaaaataatattatgctttatgatttggaataagagaacaatacaaatcgtaataaccaaaatccatgttactccaa |
192 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33414913 |
ttttttattggatgaaattcacctaaaataatcttatgctttatgatttgaaataagagaacaatacaaatcgtaataatcaaaatccatgttactccaa |
33414814 |
T |
 |
| Q |
193 |
ctagtaagcctatg |
206 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33414813 |
ctagtaagcctatg |
33414800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University