View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20148_high_62 (Length: 209)
Name: NF20148_high_62
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20148_high_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 40863146 - 40863312
Alignment:
| Q |
20 |
gtaagctggtagcattcggtgtggagttggacggtaggaaaaat---gcaacaagcaagtgtggtgtaagttttcagtttcggggataatatattcaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40863146 |
gtaagctggtagcattcggtgtggagttggacggtaggaaaaataatgcaacaagcaagtgtggtgaaagttttcagtttcggggataatatattcaaca |
40863245 |
T |
 |
| Q |
117 |
cttacccgtgtctctactttttaggcttaattatgttcgcaacaatggtgtttattttagtgatact |
183 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40863246 |
cttactcgtgtctctactttttaggcttaattatgttcgcaacaatggtgtttattttagtggtact |
40863312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University