View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20148_low_16 (Length: 426)
Name: NF20148_low_16
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20148_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 2e-81; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 86 - 247
Target Start/End: Complemental strand, 51769036 - 51768875
Alignment:
| Q |
86 |
tgagcagaggtgtcgccaaaaatatccgaatcataacaattttttgacatgagatattatttttacacaattgtcttttaacataagatattatttgtgt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51769036 |
tgagcagaggtgtcgccaaaaatatccgaatcaaaacaattttttgacatgagatattatttttacacaattgtcttttaacataagatattatttgtgt |
51768937 |
T |
 |
| Q |
186 |
ctttttatttcttccagtcatgtcatgattagccaagttatacggtctcgtaagcacttgtt |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51768936 |
ctttttatttcttccagtcatttcatgattagccaagttatacggtctcgtaagcacttgtt |
51768875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 272 - 408
Target Start/End: Complemental strand, 51768873 - 51768737
Alignment:
| Q |
272 |
actctgaattttaccgctcatgcagtataaacacctgactatcaactttttctcatgggaaaataagaattctcctaaaaaatacataaatcccatcgtg |
371 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51768873 |
actctgaattttaccactcatgcagtataaacacctgactatcaactttttctcatgggaaaataagaattctcctaaaaaatacataaatcccatcgtg |
51768774 |
T |
 |
| Q |
372 |
agaaggactataagatatcaaattactatgtttgttg |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51768773 |
agaaggactataagatatcaaattactatgtttgttg |
51768737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 13 - 46
Target Start/End: Complemental strand, 51769108 - 51769075
Alignment:
| Q |
13 |
aaaatcatgggatgtgcgttggataaatgcttct |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51769108 |
aaaatcatgggatgtgcgttggataaatgcttct |
51769075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University