View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20148_low_46 (Length: 279)

Name: NF20148_low_46
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20148_low_46
NF20148_low_46
[»] chr6 (1 HSPs)
chr6 (34-215)||(30419274-30419454)


Alignment Details
Target: chr6 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 34 - 215
Target Start/End: Complemental strand, 30419454 - 30419274
Alignment:
34 ttcacacaaagcggaggttaggggacgatgataggttacatcaatcatctttctcatattaccacattatttttcttcacaaacttcccagatggtgata 133  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
30419454 ttcacacaaagcggaggttaggggacggtgataggttacatcaatcatctttctcatattaccacattatttttcttcacaaacttctcagatggtgata 30419355  T
134 gagtggtggatctttgagggnnnnnnnnnctttctaaattcgggagagtgcgagaggtgtatatttcaaaaaagcttaataa 215  Q
    ||||||||||||||||||||         |||||||||||| ||||||||||||||||||||||||||||||||||| ||||    
30419354 gagtggtggatctttgaggg-ttttttttctttctaaattcaggagagtgcgagaggtgtatatttcaaaaaagcttgataa 30419274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University