View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20148_low_54 (Length: 242)
Name: NF20148_low_54
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20148_low_54 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 2249631 - 2249867
Alignment:
| Q |
18 |
aattttgtgtctgttgttggaattcgttggagattattaaatgtagttgaagt------------caatgagtgtgagatagactttatatagtgtccca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2249631 |
aattttgtgtctgttgttggaattcgttggagattattaaatgtagttgaagttggttaggattacaatgagtgtgagatagactttatatagtgtccca |
2249730 |
T |
|
| Q |
106 |
accgcatttagaatctccacggttgggattttctagcattcatggagacaggacattggtggtcgtttgatcaagatcatacgattcaaattcaaacttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2249731 |
accgcatttagaatctccacggttgggattttctagcattcatggagacaggacattggtggtcgtttgatcaagatcatacgattcaaattcaaacttt |
2249830 |
T |
|
| Q |
206 |
atattttaaattgtaaaattaaagtcttgcatttgtt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2249831 |
atattttaaattgtaaaattaaagtcttgcttttgtt |
2249867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University