View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20148_low_57 (Length: 230)
Name: NF20148_low_57
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20148_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 2250115 - 2249898
Alignment:
| Q |
1 |
gtggtgatacctatgagtactcacccaatcaattggatttccctgcacatcaaaaccaaaacaacatttcatat--tcccttcaataagaaaactatgaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2250115 |
gtggtgatacctatgagtactcacccaatcaattggatttccctgcacatcaaaatcaaaacaacatttcatatattcccttcaataagaaaactatgaa |
2250016 |
T |
 |
| Q |
99 |
gaatataaaaagatgttagaattagtaggagattattaaagatagttaaaacttagttaggattgaatttggattccctgccaccaggggatctcacatt |
198 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2250015 |
gaataaaaaaagatgttagaattagtaggagattattaaagatagttaaaactaagttaggattgaatttggattccctgccacccggggatctcacatt |
2249916 |
T |
 |
| Q |
199 |
caagacatcagtgatagt |
216 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2249915 |
caagacatcagtgatagt |
2249898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University