View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20148_low_66 (Length: 209)

Name: NF20148_low_66
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20148_low_66
NF20148_low_66
[»] chr8 (1 HSPs)
chr8 (20-183)||(40863146-40863312)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 40863146 - 40863312
Alignment:
20 gtaagctggtagcattcggtgtggagttggacggtaggaaaaat---gcaacaagcaagtgtggtgtaagttttcagtttcggggataatatattcaaca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
40863146 gtaagctggtagcattcggtgtggagttggacggtaggaaaaataatgcaacaagcaagtgtggtgaaagttttcagtttcggggataatatattcaaca 40863245  T
117 cttacccgtgtctctactttttaggcttaattatgttcgcaacaatggtgtttattttagtgatact 183  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
40863246 cttactcgtgtctctactttttaggcttaattatgttcgcaacaatggtgtttattttagtggtact 40863312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University