View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20148_low_67 (Length: 208)

Name: NF20148_low_67
Description: NF20148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20148_low_67
NF20148_low_67
[»] chr5 (1 HSPs)
chr5 (24-187)||(32447723-32447885)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 24 - 187
Target Start/End: Complemental strand, 32447885 - 32447723
Alignment:
24 ggtttggggtctattccctgtcgatcctctttccggtacccattcaaaccttcgtagttttgttacctttcaatttatttattttataggtattgatttg 123  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
32447885 ggtttggggtctattccccgtcgatcctctttccggtacccattcaaaccttcgtagttttgttacctttcaattttttt-ttttataggtattgatttg 32447787  T
124 taccaataatttcatttgattacggcaggtgaagataattactacattttcaaacctggaactt 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32447786 taccaataatttcatttgattacggcaggtgaagataattactacattttcaaacctggaactt 32447723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University