View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20149_low_9 (Length: 221)
Name: NF20149_low_9
Description: NF20149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20149_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 38918206 - 38918345
Alignment:
| Q |
1 |
ctttcacaaattttgtttatgctcttcatatatactaatagtagtagctagaactcattgtcaattttcttacaaataaaaggtatccccaacacgtaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38918206 |
ctttcacaaattttgtttatgctcttcatatatactaatagtagtagctagaactcattgtcaattttcttacaaataa-----------aacacgtaaa |
38918294 |
T |
 |
| Q |
101 |
aacctaacccccttaacttaagtaatccttagatcaggttacatacatcta |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918295 |
aacctaacccccttaacttaagtaatccttagatcaggttacatacatcta |
38918345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 221
Target Start/End: Original strand, 38918383 - 38918415
Alignment:
| Q |
189 |
gagcaagcgacaatatcgagtagaagtcaagat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38918383 |
gagcaagcgacaatatcgagtagaagtcaagat |
38918415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University