View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_103 (Length: 236)
Name: NF2014_high_103
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_103 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 17993200 - 17993369
Alignment:
| Q |
1 |
ctttcaagtttatgatttttaatgg-ttaaacaacaaatttgggatctaacctttctcaacaatcaccttcgttgtactcgaatggtggtataaggtaga |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17993200 |
ctttcaagtttatgatttttaatgggttaaacaacaaatttgggatctaacctttctcaacaatcaccttcgttgtactcgaatggtggta--aggtaga |
17993297 |
T |
|
| Q |
100 |
gagtttgtaggttttcttggtttggatttgtgagtttaatggagaaatgttttctaggcccggtttgcatta |
171 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
17993298 |
gagtttgtaggttttcttggtttgggtttgtgagtttaatggagaaatgttttctgggccaggtttgcatta |
17993369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 19318461 - 19318403
Alignment:
| Q |
1 |
ctttcaagtttatgatttttaat-ggttaaacaacaaatttgggatctaacctttctcaa |
59 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||||||||||| ||||||||||| |
|
|
| T |
19318461 |
ctttcaagtttatgatttttaataggttaaataaaaaatttgggatct-acctttctcaa |
19318403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Original strand, 17993828 - 17993860
Alignment:
| Q |
171 |
agaagcaaacacacaaccatgagaggaacacac |
203 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
17993828 |
agaatcaaacacacaaccatgagaggaacacac |
17993860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University