View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_107 (Length: 227)
Name: NF2014_high_107
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_107 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 40 - 227
Target Start/End: Original strand, 8777466 - 8777653
Alignment:
| Q |
40 |
ttagagaaaacattgatatgttcgattggactgcaacatccatgcatggaattaacctcaatatagtatgtaccaaatggcaatcaaccctaatgcaaaa |
139 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8777466 |
ttagataaaacattgatatgttcgattggactgcaacatccatgcatggaattaacctcaatatagcatgtaccaaatggcaatcaaccctaatgcaaaa |
8777565 |
T |
 |
| Q |
140 |
acagtggctcagcgccgtaagaagaagtctcccaaaaagggaggctgcagaaaaagttggaaaaaacctcctacaagaaaattgtatt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8777566 |
acagtggctcagcgccgtaagaagaagtctcccaaaaagggaggctgcagaaaaagttggaaaaaacctcctacaagaaaattgtatt |
8777653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 8762812 - 8762855
Alignment:
| Q |
1 |
gccaaaactggtaattaagggcgcggttcaatgcatgcattaga |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8762812 |
gccaaaactggtaattaagggcgcagttcaatgcatgcattaga |
8762855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University