View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_114 (Length: 211)
Name: NF2014_high_114
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_114 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 27 - 147
Target Start/End: Original strand, 17339836 - 17339957
Alignment:
| Q |
27 |
aatgtccaaatacaaattgtcagagtggtttctatctgctatatatttaatcctctttctcaaaccctttgagttattaa-gggtcattttttactctaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17339836 |
aatgtccaaatacaaattgtcagagtggtttctatctgctatatatttaatcctctttctcaaaccctttgagttattaaggggtcattttttactctaa |
17339935 |
T |
 |
| Q |
126 |
ttgtccttggtagataaatgaa |
147 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
17339936 |
ttgtctttggtagataaatgaa |
17339957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 161 - 198
Target Start/End: Original strand, 17339996 - 17340033
Alignment:
| Q |
161 |
actatattcgtttgtgtgaaagggcgcaatcctaggga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17339996 |
actatattcgtttgtgtgaaagggcgcaatcctaggga |
17340033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University