View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_116 (Length: 204)
Name: NF2014_high_116
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_116 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 34173000 - 34172815
Alignment:
| Q |
1 |
ttgtattagagatggatgtggttcaataaaatattaaagcatctcatagtaagaataaaagcaaccatgaccggaggagaaaatacttgaactttttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34173000 |
ttgtattagagatggatgtggttcaataaaatattaaagcatctcatagtaagaataaaagcaaccatgaccagaggagaaaatacttgaactttttaga |
34172901 |
T |
|
| Q |
101 |
gggtgata-atatttttaagagtcacttcaacggttcaaccgcttaggttgggagagcattgaaaatgggtaaatttaactctcat |
185 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34172900 |
gggtgatatatatttttaagagtcacttcaacggttcaaccgcttaggttgggagagcattgaaaatgggtaaattgaactctcat |
34172815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University