View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_117 (Length: 203)
Name: NF2014_high_117
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_117 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 48483593 - 48483422
Alignment:
| Q |
14 |
gatgaacttataaatttatgatgtgttcataagtttcctttggcatatgtttgaagtcctagcattgtcaacttaccatttaaatggcccctttcccctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48483593 |
gatgaacttataaatttatgatgtgttcataagttgcctttggcttatgtttgaagtcctagcattgtcaacttaccatttaaatggcccctttcccctt |
48483494 |
T |
 |
| Q |
114 |
ttaatttttatgctgcggttgtatttgtttatccattgctaatttgtttttataatatggggaaactctttg |
185 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48483493 |
ttaatttttatgctgcggttgtatttttttatccattgctaagttgtttttataatatggggaaactctttg |
48483422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University