View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_118 (Length: 203)
Name: NF2014_high_118
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_118 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 31132957 - 31133086
Alignment:
| Q |
1 |
tagaaagggagaccacttgttcctcttttctttttgcttagctgaggaagttcttagttattaaggtctaaacaagcttgtggagatggaccagttgaag |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31132957 |
tagaaagggagaccccttgttcctcttttctttttgcttagctgaggaagttcttagttattaaggtctaaacaagcttgtggagatggaccagttgaag |
31133056 |
T |
 |
| Q |
101 |
ctcataagagaaaccaaatcaaatgaaatc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31133057 |
ctcataagagaaaccaaatcaaatgaaatc |
31133086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University