View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_29 (Length: 389)
Name: NF2014_high_29
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 5 - 372
Target Start/End: Original strand, 7679654 - 7680020
Alignment:
| Q |
5 |
aacaataccttccaaacttaaggcaaatttcttcttggtttcatcaggacaatacttcaagcctctcaaatctgcatcatcaattttcccaacaatgata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7679654 |
aacaataccttccaaacttaaggcaaattt-ttcttggtttcatcaggacaatacttcaagcctctcaaatctgcatcatcaattttcccaacaatgata |
7679752 |
T |
 |
| Q |
105 |
gggatggaatcaggattgattcccaatgacttcaaataaaagttacattcttcatagggatcaatagcaaaggtcggaatggaatacgatgtcgtggcag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7679753 |
gggatggaatcaggattgattcccaatgacttcaaataaaaggtacattcttcatagggatcaataacaaaggtcggactggaatacgatgtcgtggcag |
7679852 |
T |
 |
| Q |
205 |
cactagaaggagtagtaaaggtcgctctgggataccgtgtaggttgcccactagaaccagagaaggttcttggagggcttatgctcctaggcctttcgat |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7679853 |
cactagaaggagtagtaaaggtcgctctgggataccgtgtaggttgcccgctagaaccatagaaggttcttggagggcttctgctcctaggcctttcgat |
7679952 |
T |
 |
| Q |
305 |
ttcattctcaccttccgtcataaaacttgggatattgagcttattcttccccttaaacaaaagagtca |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7679953 |
ctcattctcaccttccgtcataaaacttgggatattgagcttattcttccccttaaacaaaagagtca |
7680020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University