View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_31 (Length: 381)
Name: NF2014_high_31
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 17 - 368
Target Start/End: Original strand, 45460095 - 45460446
Alignment:
| Q |
17 |
aagttggtccagtgcctgccaccctttatttctaagatgccttttttagtcgctttgctaaagtgattgctggtgatgacatactgcaggtccatccaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460095 |
aagttggtccagtgcctgccaccctttatttctaagatgccttttttagtcgctttgctaaagtgattgctggtgatgacatactgcaggtccatccaaa |
45460194 |
T |
 |
| Q |
117 |
catgtattcatagtattgtccctactttcttcggctgtcggaagccaagcaactataacagccagcttctccatcattaaccaatgtctagcactaaatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460195 |
catgtattcatagtattgtccctactttcttcggctgtcggaagccaagcaactataacagccagcttctccatcattaaccaatgtctagcactaaatt |
45460294 |
T |
 |
| Q |
217 |
gttttcccagagtaaaagtcattcacacatcaaaaacaatacatggccagatttacatctccgatgtcaactggttattgatgattttcagtctagctgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460295 |
gttttcccagagtaaaagtcattcacacatcaaaaacaatacatggccagatttacatctccgatgtcaactggttattgatgattttcagtctagctgt |
45460394 |
T |
 |
| Q |
317 |
gacggttggtttcagagacatggtgaagattggcaacgcaacaagtatgcca |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460395 |
gacggttggtttcagagacatggtgaagattggcaacgcaacaagtatgcca |
45460446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University