View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_37 (Length: 357)
Name: NF2014_high_37
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 19 - 342
Target Start/End: Complemental strand, 40857281 - 40856958
Alignment:
| Q |
19 |
atcaatagcatgaaaaaagatcaattatcatgaagaaaatgaaactagaatcagtgacctatttaaagcagaaatgaatcacttacagcatctacagatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40857281 |
atcaatagcatgaaaaaagatcaattatcatgaagaaaatgaaactagaattagtgacctatttaaagcagaaatgaatcacttacagcatctacagatg |
40857182 |
T |
|
| Q |
119 |
cttgagcggggcctttaaaataattgagtgagctctctaggaggcgtcggtaaccttgctcgggagcaattagatgaggttggtatccatccgcctcaga |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40857181 |
cttgagcgggacctttaaaataattgagtgagctctctaggaggcgtcggtaaccttgctcgggagcaattagatgaggttggtatccatctgcctcaga |
40857082 |
T |
|
| Q |
219 |
aacaacgtttctcacattttgcagcgataaatgacggtccagtggaatctttctcaatgcagcaggaagctgataatcgaaaactatataaattttgtca |
318 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40857081 |
aataacgtttctcacattttgcagcgataaatgacggtccagtggaatctttctcaatgcagcaggaagctgataatcgaaaactatataaattttgtca |
40856982 |
T |
|
| Q |
319 |
ccacctggtcgcctagggaggggg |
342 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40856981 |
ccacctggtcgcctagggaggggg |
40856958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University