View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2014_high_68 (Length: 274)

Name: NF2014_high_68
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2014_high_68
NF2014_high_68
[»] chr4 (1 HSPs)
chr4 (13-257)||(44574816-44575060)


Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 257
Target Start/End: Complemental strand, 44575060 - 44574816
Alignment:
13 catcacataaagggaaaacaccttggttaggtggtcaagatttaaatcatactaggcttgattactattattatttaattgcttccattggagttttgaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44575060 catcacataaagggaaaacaccttggttaggtggtcaagatttaaatcatactaggcttgattactattattatttaattgcttccattggagttttgaa 44574961  T
113 ttttatctatttcaacttctttgcttgccattatttgataagtggcaaggaaattgagaaagctgaggtgcaaccaattgctagtgtgaagggagaatca 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44574960 ttttatctatttcaacttctttgcttgccattatttgataagtggcaaggaaattgagaaagctgaggtgcaaccaattgctagtgtgaagggagaatca 44574861  T
213 gatgaacaagatgatgaggaaaaggttttggatagagtaggcact 257  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
44574860 gatgaacaagatgatgaggaaaaggttttggatagagtaggcact 44574816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University