View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_68 (Length: 274)
Name: NF2014_high_68
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 257
Target Start/End: Complemental strand, 44575060 - 44574816
Alignment:
| Q |
13 |
catcacataaagggaaaacaccttggttaggtggtcaagatttaaatcatactaggcttgattactattattatttaattgcttccattggagttttgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575060 |
catcacataaagggaaaacaccttggttaggtggtcaagatttaaatcatactaggcttgattactattattatttaattgcttccattggagttttgaa |
44574961 |
T |
 |
| Q |
113 |
ttttatctatttcaacttctttgcttgccattatttgataagtggcaaggaaattgagaaagctgaggtgcaaccaattgctagtgtgaagggagaatca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574960 |
ttttatctatttcaacttctttgcttgccattatttgataagtggcaaggaaattgagaaagctgaggtgcaaccaattgctagtgtgaagggagaatca |
44574861 |
T |
 |
| Q |
213 |
gatgaacaagatgatgaggaaaaggttttggatagagtaggcact |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574860 |
gatgaacaagatgatgaggaaaaggttttggatagagtaggcact |
44574816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University