View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_88 (Length: 245)
Name: NF2014_high_88
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_88 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 4 - 228
Target Start/End: Complemental strand, 15415107 - 15414883
Alignment:
| Q |
4 |
acagagtgcaatagactcacaactgattcctccctctttgcagtaacaatcaatcctcgaaccatcttccttatatccgaaaggattattgcctaagcca |
103 |
Q |
| |
|
||||||| | ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15415107 |
acagagtacgatagactcacaacggattcctccctcttcgcagtaacaatcaatcctcgaaccatcttccttatatccgaaaggattattgcctaagcca |
15415008 |
T |
 |
| Q |
104 |
aattcacctgcccatgcttcaaattcaatgccaaattttgaacaggactttccggttagtgggtagatatggtcaatcccctaaaccaaatcatatgtta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15415007 |
aattcacctgcccatgcttcaaattcaatgccaaattttgaacaggactttccggtcaacgggtagatatggtcaatcccataaaccaaatcatatgtta |
15414908 |
T |
 |
| Q |
204 |
caatttgttgaatattgtttaaggt |
228 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15414907 |
caatttgttgaatattgtttaaggt |
15414883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University