View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_89 (Length: 245)
Name: NF2014_high_89
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_89 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 31 - 244
Target Start/End: Original strand, 2437626 - 2437842
Alignment:
| Q |
31 |
atggcattccctggcctaattgtaactttagcatcaagcaaactaaagttaacaataggtcaggtcaaaacttgttcaactggtaaccgaaccaaatcac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2437626 |
atggcattccctggcctaattgtaactttagcattaagcaaactatagttaacaataggtcaggtcaagacttgttcaactggtaaccgaaccaaatcac |
2437725 |
T |
 |
| Q |
131 |
attaaaatagaaatactt---atcttaatttgcgattgtaatatgatacataactttagaacaaaaaatgtgacttatgttttgaagtttcatcctttct |
227 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2437726 |
attaaaatagaaatatttatcatcttaatttgcgattgtaatatgatacataactttagaacaaaaaatgtgacttatgttttgaagtttcatcctttct |
2437825 |
T |
 |
| Q |
228 |
ctcgagttcacatcgat |
244 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
2437826 |
ctcgagttcacgtcgat |
2437842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University