View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_high_98 (Length: 238)
Name: NF2014_high_98
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_high_98 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 12265865 - 12266085
Alignment:
| Q |
1 |
cttcttaagttactatagattgaagaaatatggcaatgattgagctgaagaaagttcttgtgatcatgttcatgattattattattatgctagttgtagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12265865 |
cttcttaagttactatagattgaagaaatatggcaatgattgagctgaagaaagttcttgtgatcatgttcatgatta---ttattatgctagttgtagt |
12265961 |
T |
|
| Q |
101 |
tcaactatgtgacaccactcaatcaaaaatagttgatgaaagttgtgctatagagcgttttgcttgtcgtgcagagtgtcttgtaacatgtgctggtttt |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12265962 |
tcaactatgtgacactactcaatcaaaaatagttgatgaaagttgtgctatagagcgttttgcttgtcgtgcagagtgtcttataacatgtgctggtttt |
12266061 |
T |
|
| Q |
201 |
gataattgcttggaaggttgtttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
12266062 |
gataattgcttggaaggttgtttt |
12266085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University