View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_106 (Length: 240)
Name: NF2014_low_106
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_106 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 47909212 - 47909416
Alignment:
| Q |
1 |
caaaatatattccaacccattatttatcacatgtatgcttatatgttgaagtttatgtgagacccgcataatttatagagtttcgtccaaatttcaacca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47909212 |
caaaatatattctaacccattatttaacacatgtatgcttatatgttgaagtttatgtgagatccgcataatttatagattttcgtccaaatttcaacca |
47909311 |
T |
|
| Q |
101 |
ttaaaaatgtgtgttttgagaatgtgttgctagtgctcctttaatttccttcctatttttaaagagtactaacaacacactctaggaatcatgcatctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47909312 |
ttaaaaatgtgtgttttgagaatgtgttgctagtgctcctttaatttccttcctatttttaaagagtactaacaacacactctaggaatcatgtatctat |
47909411 |
T |
|
| Q |
201 |
tctct |
205 |
Q |
| |
|
||||| |
|
|
| T |
47909412 |
tctct |
47909416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University