View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_114 (Length: 237)
Name: NF2014_low_114
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_114 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 8743088 - 8743307
Alignment:
| Q |
1 |
tttttattttaaaacattggggttgttaattatttgagttgagttcaacggtctcaatcnnnnnnnn-tattaagatcaaaacggtctctttgcttcaat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8743088 |
tttttattttaaaacattggggttgttaattatttgagtcgagttcaacggtctcaatcaaaaaaaaatattgagatcaaaacggtctctttgcttcaat |
8743187 |
T |
 |
| Q |
100 |
tacaagtgagtcccattgatcgataatatgaagtggatgcctgttggaatgtgtaaatcgaaatttaataaaacattttgcatgtgagttagtttggatc |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8743188 |
tacaagtgagtcccattgatcgattatatgaagtggatgcccgttggaacgtgtaaatcgaattttaataaaacattttgcatgtgaattagtttggatc |
8743287 |
T |
 |
| Q |
200 |
gacttatattaactcataaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8743288 |
aacttatattaactcataaa |
8743307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University