View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_120 (Length: 229)
Name: NF2014_low_120
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_120 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 30637251 - 30637032
Alignment:
| Q |
1 |
cttgcattgttgttcttgttccaaacatttgtaaatggcaacatcagaagaatctcgtattgtgtgacattgcttcttttcaagaaacagaagctgcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30637251 |
cttgcattgttgttcttgttccaaacatttgtaaatggcaacatcagaagaatctcgtattgtgtgacattgcttcttttcaagaaagagaagctgcatt |
30637152 |
T |
 |
| Q |
101 |
attaggagttaattaatgaccattatatggaatttaaaataaagtacag-nnnnnnnnnnatcaaaaacataaaataaaaatacattaatgtaaaattct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30637151 |
attaggagttaattaatgaccattatatggaacttaaaataaagtacagtttttttttttatcaaaaacataaaataaaaatacataaatgtaaaattct |
30637052 |
T |
 |
| Q |
200 |
agtgaagaaatatttaattt |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30637051 |
agtgaagaaatatttaattt |
30637032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University