View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2014_low_134 (Length: 202)

Name: NF2014_low_134
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2014_low_134
NF2014_low_134
[»] chr3 (1 HSPs)
chr3 (50-187)||(51185385-51185522)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 51185522 - 51185385
Alignment:
50 ttcacgaagaattgctctctttcatcttctcaccactggtggtattggtaatctctctacttttcaccacctcatcctcaaagccttcattcatgtattt 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51185522 ttcacgaagaattgctctctttcatcttctcaccactggtggtattggtaatctctctacttttcaccacctcatcctcaaagccttcattcatgtattt 51185423  T
150 atctatttatgttatgactttgacttagttagttctct 187  Q
    ||||||||||||||||||||||||||||||||||||||    
51185422 atctatttatgttatgactttgacttagttagttctct 51185385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University