View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_26 (Length: 424)
Name: NF2014_low_26
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 1 - 412
Target Start/End: Complemental strand, 21003614 - 21003203
Alignment:
| Q |
1 |
aagtctaggcggtttgataaagtgaaaagtttggtttgcgaaatggagaaccgtggtttggttaaactttcttcgatggagagtccgctttcaaaggcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21003614 |
aagtctaggcggtttgataaagtgaaaagtttggtttgcgaaatggagaaacgtggtttggttaaactttcttcgatggagagtccgctttcaaaggcgt |
21003515 |
T |
|
| Q |
101 |
ttcggattttgggattgaaccctttgagtgtgaggttgaaacgagacaacaacaagaaacttttcaaagcggagttctttgacgaaatgggaaatggact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21003514 |
ttcggattttgggattgaaccctttgagtgtgaggttgaaacgagacaacaacaagaaacttttcaaagcggagttctttgacgaaatgggaaatggact |
21003415 |
T |
|
| Q |
201 |
ttatttggatacagatgtagacgagtttgagaaccacgttgcttcaattcttgaagagtctgtgttaccgaacttcagttcatctgtcaaaaaagaatgc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21003414 |
ttatttggatacagatgtagacgagtttgagaaccacattgcttcaattcttgaagagtctgtgttaccgaacttcagttcatctgtcaaaaaagaatgc |
21003315 |
T |
|
| Q |
301 |
agcagtaataacctaaaaaatgcattggttttggttgaagaaacgctttgttggggtcaagaattgttgttgcctgaactctcgatgttagtgacacagc |
400 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21003314 |
agcagtaataaccttaaaaatgcattggttttggttgaagaaatgctttgttgggatcaagaattgttgttgcctgaactctcgatgttagtgagacagc |
21003215 |
T |
|
| Q |
401 |
tttgttcatctc |
412 |
Q |
| |
|
|||||||||||| |
|
|
| T |
21003214 |
tttgttcatctc |
21003203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University