View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_39 (Length: 373)
Name: NF2014_low_39
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 8e-83; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 29 - 184
Target Start/End: Complemental strand, 8743086 - 8742931
Alignment:
| Q |
29 |
taacctttactaccaaacacagtcttcaaaacgacaaaatgttgtttaactttatcaaaagaaaaagaagagtatttttcaagaacaagatgtacaacac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8743086 |
taacctttactaccaaacacagtcttcaaaacgacaaaatgttgtttaactttatcaaaagaaaaagaagagtatttttcaagaacaagatgtacaacac |
8742987 |
T |
 |
| Q |
129 |
cacaagagagcatgtaactctatcaatgaaataattttatcaaatctaccttttaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742986 |
cacaagagagcatgtaactctatcaatgaaataattttatcaaatctaccttttaa |
8742931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 167 - 255
Target Start/End: Complemental strand, 8742915 - 8742827
Alignment:
| Q |
167 |
atcaaatctaccttttaagataaattaatttatgtcatgctaatgaatttatgtctaattaagataaaatcagtccatcaaagcagcaa |
255 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
8742915 |
atcaaatctaccttctaagataaattaatttatgtcatgctaatgaatttatgtctaattaagataaaaccagtctatcaaagcagcaa |
8742827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 283 - 314
Target Start/End: Complemental strand, 8742629 - 8742598
Alignment:
| Q |
283 |
atttatttacaatattatttgacaaaaattct |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8742629 |
atttatttacaatattatttgacaaaaattct |
8742598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University