View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_72 (Length: 281)
Name: NF2014_low_72
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 49133569 - 49133833
Alignment:
| Q |
1 |
aattggtaccatagcctatgcttgtatgcaggtagtttgctatccctatatgaatttctcatacatttatttattgataatataactgtacttttataac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133569 |
aattggtaccatagcctatgcttgtatgcaggtagttttctatccctatatgaatttctcatacatttatttattgataatataactgtacttttataac |
49133668 |
T |
 |
| Q |
101 |
agcatatattaaaatgaatgacaggttccattcactattttgggagccattttgatggataagtctggaagaagaccacttataacggtaattctattat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133669 |
agcatatattaaaatgaatgacaggttccattcactattttgggagccattttgatggataaatctggaagaagaccacttataacggtaattctattat |
49133768 |
T |
 |
| Q |
201 |
caagtatctaaattttttgataataccgttgataaggggaaatgcctaatagaagtgtctatatg |
265 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133769 |
caagtatctaaaatttttgataataccgttgataaggggaaatgcctaatagaagtgtctatatg |
49133833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 192
Target Start/End: Original strand, 6927523 - 6927575
Alignment:
| Q |
140 |
ttgggagccattttgatggataagtctggaagaagaccacttataacggtaat |
192 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||| |||||||| ||||| |
|
|
| T |
6927523 |
ttgggagccattttgatggacaagtctggaagaaaacctcttataacagtaat |
6927575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University