View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_74 (Length: 276)
Name: NF2014_low_74
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_74 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 16 - 276
Target Start/End: Original strand, 47183729 - 47183989
Alignment:
| Q |
16 |
aggatttacaacgggttcaagtgacgtaatttttgaggcgaagatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgttt |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47183729 |
aggatttacaacgggttcaagtgatgtaatttttgaggcgaagatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgttt |
47183828 |
T |
|
| Q |
116 |
gggtatgatattggtatttcaggtacatttatattgccttattctaaaggtttttgttctgattttgtatttatacgttcttatgatattggtaacttga |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47183829 |
ggttatgatattggtatttcaggtacatttatatagccttattctaaaggtttttgttctgattttgtacttatacgttcttatgatattggtaacttga |
47183928 |
T |
|
| Q |
216 |
gatcaaattctaactagatcaatctatgttcaaattttatttatcttatgaccaaaactcc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47183929 |
gatcaaattctaactagatcaatctatgttcaaattttatttatcttatgaccaaaactcc |
47183989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 16 - 144
Target Start/End: Original strand, 47196617 - 47196745
Alignment:
| Q |
16 |
aggatttacaacgggttcaagtgacgtaatttttgaggcgaagatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| | ||||||| |||| || | | |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
47196617 |
aggatttacaacgggttcaagtgacgtcgtttttgaggctaggatcacagcagctgttgtgatctcttgcatcatggctgctactggtggtcttatgttt |
47196716 |
T |
|
| Q |
116 |
gggtatgatattggtatttcaggtacatt |
144 |
Q |
| |
|
|| |||||| ||||||||||||||||||| |
|
|
| T |
47196717 |
ggttatgatgttggtatttcaggtacatt |
47196745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 86 - 139
Target Start/End: Complemental strand, 751544 - 751491
Alignment:
| Q |
86 |
attatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggt |
139 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||| ||||| |||||||| |
|
|
| T |
751544 |
attatggctgctaccggtggtcttatgttcggttatgatgttggtgtttcaggt |
751491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University